Journal: Nature Communications

Article Title: Two-input protein logic gate for computation in living cells

doi: 10.1038/s41467-021-26937-x

Figure Lengend Snippet: a Images of rapamycin-treated Ch -FAK-expressing FAK −/− fibroblasts treated with control (DMSO) and FAK inhibitor 14. Top panel shows the Ch -FAK-activated FAK −/− cells treated with control. Arrows indicate focal adhesions. Bottom panel shows same set of cells treated with FAK inhibitor 14. Scale bar, 20 μm. b Images of Ch- FAK-expressing FAK −/− fibroblasts without (top) and with (bottom) rapamycin stained with phalloidin to reveal stress fibers (magenta). Large focal adhesions formed by the activation of Ch -FAK are visible as red clusters (mCherry fluorescence) at the ends of stress fibers in bottom panel. Nuclei were stained with Hoechst (blue). Individual channels are shown to the right of the merged images. Scale bar, 20 μm. c Images of rapamycin-treated Ch -FAK-expressing FAK −/− fibroblasts treated with control (DMSO) (top) or blebbistatin (bottom). Red indicates phalloidin stained stress fibers and green indicates Hoechst-stained nucleus. Scale bar, 40 μm.

Article Snippet: We stained F-actin with Alexa Fluor phalloidin conjugates (ThermoFisher Scientific; 10 U/mL in 1% BSA PBS) and chromatin with 1:1000 Hoechst solution (Tocris).

Techniques: Expressing, Control, Staining, Activation Assay, Fluorescence

Journal: Frontiers in Neural Circuits

Article Title: Cre-Recombinase Dependent Germline Deletion of a Conditional Allele in the Rgs9cre Mouse Line

doi: 10.3389/fncir.2018.00068

Figure Lengend Snippet: Germline recombination of Rem2 conditional alleles by Rgs9cre driver mice. (A) Summary of anticipated and observed genotypes. (B) Schematic of Rem2 gene showing the wildtype allele, conditional allele with Lox P sequences flanking exons two and three, and knockout allele following Cre-recombinase (Cre) dependent deletion. Two primer sets were used to distinguish the three alleles. Primer set one flanked the 5′ Lox P site, while primer set two flanked the entire floxed region. Note that the complementary DNA sequence for the reverse primer of Primer set 1 is excised following recombination, which results in failed polymerase chain reaction (PCR) amplification. (C) PCR results from genomic DNA (gDNA) purified from ear biopsies. PCR using primer set 1 produced two possible amplicons corresponding to the wildtype (221 bp) and Lox P conditional (327 bp) alleles. PCR with primer set 2 resulted in three possible amplicons corresponding to the wildtype (1,915 bp; not shown), Lox P conditional (2,065 bp; not shown), and Cre-dependent deleted (338 bp) alleles. The Cre PCR reaction contained primers within the Cre coding sequence (200 bp) and PCR control primers (350 bp). (D) Allele frequency and germline genotype frequency predicted for the cross, Rem2 LoxP/LoxP Rgs9 WT/WT × Rem2 LoxP/WT Rgs9 Cre/WT , and observed frequencies when the Cre gene was inherited from the female or male parent. (E) RT-qPCR from gonad cDNA showing Cre expression in Cre + mice. (F) RT-qPCR from striatum and hippocampus cDNA showing nonconditional Rem2 knockout. # p < 0.05 compared to LoxP/LoxP; Cre-STR; * p < 0.05 compared to LoxP/LoxP; Cre-HC. GD, germline deletion. ND, not detected.

Article Snippet: After purification, 500 ng (brain tissues) or 1 μg (ovaries and testis) of RNA was reverse transcribed using the QuantiTect Reverse Transcription kit (Qiagen) and diluted to an estimated 5 ng/μL (cDNA was not diluted for Cre reactions). qPCR was performed in triplicate on a StepOnePlus thermocycler using 2 μL (5 μL for Cre reactions) cDNA template, Universal Master Mix II, and predesigned TaqMan Gene Expression Assays (all from ThermoFisher Scientific) for Rem2 ( Mm00600529_m1, spanning exons three and four), Cre (Mr00635245_cn), and actb (4352933E).

Techniques: Knock-Out, Sequencing, Polymerase Chain Reaction, Amplification, Purification, Produced, Control, Quantitative RT-PCR, Expressing

Journal: PLoS Biology

Article Title: A high-throughput screen of real-time ATP levels in individual cells reveals mechanisms of energy failure

doi: 10.1371/journal.pbio.2004624

Figure Lengend Snippet: (A) K562 lines were generated expressing the dCas9-KRAB, Clover-mApple ATP FRET sensor, and 1 sgRNA against MRPL10 or non-targeting control guides (Cont1, Cont2), and ATP levels were assessed by flow cytometry. Compared with the ATP level in basal conditions, MRPL10 knockdown decreased ATP to a greater extent in respiratory conditions (box and whisker plots; line = median; box = 25th–75th percentile; whisker = 5th–95th percentile). In contrast, in glycolytic conditions, ATP levels dropped similarly in MRPL10 and control groups. N = 3,128–11,971 cells examined per group for FACS. *** p < 0.001 versus both corresponding control groups by two-way ANOVA with Tukey multiple comparisons test. (B) Knockdown of MRPL10 in K562 cells also decreased ATP levels by luciferase to a greater extent in respiratory conditions. In contrast, in glycolytic conditions, ATP levels again dropped similarly in MRPL10 and control groups. Data show mean ± SEM; N = 4 wells per group from 2 independent experiments for luciferase. ** p < 0.01 versus both corresponding control groups by one-way ANOVA with Dunnett multiple comparisons test. (C) K562 cells expressing dCas9-KRAB were stably transduced with a single sgRNA corresponding to the indicated gene, identified as reducing ATP in the primary FRET-based screen. Cells were selected for sgRNA transduction as in the primary screen, allowed to recover, and then acutely incubated in respiratory or glycolytic conditions as in the primary screen. ATP concentration was measured by luciferase (CellTiter Glo 2.0). Bars represent ATP levels in drug/substrate treatment (respiratory or glycolytic) relative to cells untreated for the same time period from the same pool of cells. * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001. Error bars are mean ± SEM; N = 10–32 wells/group, compiled from 2–4 experiments per cell line. (D, E) OCR (aerobic respiration rate) and ECAR (a surrogate of glycolysis) in K562 lines were measured using a 96-well Seahorse Extracellular Flux Analyzer. Arrows show the additions of the mitochondrial uncoupler FCCP (1 μM), the ATP synthase inhibitor oligomycin (1 μM), or the mitochondrial complex I inhibitor rotenone (1 μM). Knocking down of COX11 , KPNB1 , PDSS1 , PDSS2 , or ATP5MPL significantly decreased maximal respiration (after FCCP). Stars in legend box indicate significant difference of maximal respiration after FCCP (panel D). Oligomycin and rotenone additions similarly decreased OCR in all lines (panel E), indicating similar fractions of basal oxygen consumption devoted to mitochondrial respiration (oligomycin) and nonmitochondrial consumption (rotenone). Data are compiled from 4 experiments; n = 6–18 wells per group. Error bars represent SEM. NS, p > 0.05; * p < 0.005; ** p < 0.01; *** p < 0.001; using one-way ANOVA with Dunnett multiple comparisons test. Further information about this figure can be found in . Cont, control; dCas9, dead CRISPR-associated protein 9; ECAR, extracellular acidification rate; FACS, fluorescence-activated cell sorting; FCCP, carbonyl cyanide- 4 -(trifluoromethoxy)phenylhydrazone; FRET, fluorescence resonance energy transfer; KRAB, Kruppel-associated box; NS, not significant; OCR, oxygen consumption rate; sgRNA, single guide RNA.

Article Snippet: qRT-PCR gene relative expression quantifications were performed using 7900HT Fast Real-Time PCR System (Applied Biosystem) and using FAM-MGB TaqMan Gene Expression Assays (ThermoFisher, assay ID: Hs01680112_mH—COX11; Hs01550960_g1—COX16; Hs01043634_m1—ATP5MPL; Hs00372008_m1—PDSS1; Hs01047689_m1—PDSS2; and Hs00204417_m1—NDUFA8), together with VIC-MGB human ACTB (β-actin) (ThermoFisher number 4326315E) as endogenous control. cDNAs and PCR reactions were prepared according to the protocol for Cells-to-C T kit (ThermoFisher number AM1728), using the standard reverse transcription cycle (37 °C for 6 minutes, inactivation at 95 °C for 5 minutes, hold at 4 °C), and qRT-PCR conditions (UDG Incubation: 50 °C for 2 minutes; enzyme activation: 95 °C for 10 minutes; PCR cycle: 95 °C for 15 seconds, 60 °C for 1 minute—repeat 40 cycles).

Techniques: Generated, Expressing, Control, Flow Cytometry, Knockdown, Whisker Assay, Luciferase, Stable Transfection, Transduction, Incubation, Concentration Assay, CRISPR, Fluorescence, FACS, Förster Resonance Energy Transfer

Journal: PLoS Biology

Article Title: A high-throughput screen of real-time ATP levels in individual cells reveals mechanisms of energy failure

doi: 10.1371/journal.pbio.2004624

Figure Lengend Snippet: (A) CoQ10 rescue of ATP in respiratory conditions was assessed with a mini-library of sgRNAs. Cells were pre-incubated with 50 μM CoQ10 for 5 days and then placed under respiratory conditions before sorting. Four genes showed statistically significant improvement in ATP levels (difference of untreated and CoQ10-treated ATP phenotype). Black bars indicate untreated ATP phenotypes, and gray bars show the ATP phenotype with CoQ10. PDSS2 , COQ2 , and PDSS1 have biosynthetic roles in CoQ10, and CoQ10 blocks the decrease in ATP from knocking down these genes. CoQ10 also significantly blocked the low-ATP phenotype of COX11 , which has no known CoQ10 biosynthetic role. Data from 2 experiments, 1–2 guides studied per gene, 1 million cells sorted per group. *** p < 0.001 versus non-targeting guides (with a phenotype of 0 and no change in response to CoQ10) by one-way ANOVA with Dunnett multiple comparisons test. (B) Plot of genes identified as decreasing ATP in the initial screen for rescue with CoQ10 supplementation. Genes that decreased ATP in the respiratory screen were reanalyzed with and without supplementation with CoQ10. The positive (rescue) portion of the graph is shown. x-Axis is fold-rescue by CoQ10 (phenotype in CoQ10 minus phenotype in vehicle). y-Axis is the -log 10 of the p -value ( t test on null hypothesis that the rescue was 0) based on the multiple sgRNAs tested for that gene. The figure consists of 3 repetitions of the subgenome library screen with CoQ10 and 2 without. Genes showing strong rescue with CoQ10 (either having a t test p -value of <0.05 and rescue larger than 1 SD from the average rescue of non-targeting guides, or a t test p -value of less than 0.1 and a rescue larger than 2 SDs from the average rescue of non-targeting guides) are labeled with red squares. CoQ10 biosynthetic genes are labelled with red text. Other genes that were investigated in other parts of this figure are labelled with hollow circles and blue text. (C) Rescue of low ATP by CoQ10 as measured by luciferase. K562 cells expressing dCas9-KRAB and a single sgRNA were placed in respiratory or glycolytic conditions as in the primary screen. ATP concentrations were measured by luciferase as in . Data show mean ± SEM; N = 32 wells per group compiled from 4 independent experiments. * p < 0.05; *** p < 0.001 between untreated and CoQ10-treated conditions by two-way ANOVA with Dunnett multiple comparisons test. (D) K562 cells expressing dCas9-KRAB and a single sgRNA were collected, and total CoQ10 and CoQ10H2 levels were determined by HPLC and mass spectrometry with and without supplementation of 50 μM exogenous CoQ10 in the cell culture medium. The same cells assayed for total CoQ10 were also examined for the fraction of total CoQ10 in the oxidized state with and without CoQ10 supplementation. Untreated CoQ10 total pool sizes were compared with the untreated non-targeting guide by one-way ANOVA with Dunnett multiple comparison correction. The effect of CoQ10 treatment on total pool size and CoQ10 pool oxidation was analyzed within each gene knockdown line by two-way ANOVA with Dunnett multiple comparison correction. Data show mean ± SEM; N = 7–9 replicates per group compiled from 3 independent experiments. * p < 0.05; ** p < 0.01; *** p < 0.001. Further information about this figure can be found in . CoQ10, coenzyme Q10; dCas9, dead CRISPR-associated protein 9; HPLC, high-performance liquid chromatography; KRAB, Kruppel-associated box; NS, not significant; sgRNA, single guide RNA.

Article Snippet: qRT-PCR gene relative expression quantifications were performed using 7900HT Fast Real-Time PCR System (Applied Biosystem) and using FAM-MGB TaqMan Gene Expression Assays (ThermoFisher, assay ID: Hs01680112_mH—COX11; Hs01550960_g1—COX16; Hs01043634_m1—ATP5MPL; Hs00372008_m1—PDSS1; Hs01047689_m1—PDSS2; and Hs00204417_m1—NDUFA8), together with VIC-MGB human ACTB (β-actin) (ThermoFisher number 4326315E) as endogenous control. cDNAs and PCR reactions were prepared according to the protocol for Cells-to-C T kit (ThermoFisher number AM1728), using the standard reverse transcription cycle (37 °C for 6 minutes, inactivation at 95 °C for 5 minutes, hold at 4 °C), and qRT-PCR conditions (UDG Incubation: 50 °C for 2 minutes; enzyme activation: 95 °C for 10 minutes; PCR cycle: 95 °C for 15 seconds, 60 °C for 1 minute—repeat 40 cycles).

Techniques: Incubation, Labeling, Luciferase, Expressing, Mass Spectrometry, Cell Culture, Comparison, Knockdown, CRISPR, High Performance Liquid Chromatography

Journal: Journal of visualized experiments : JoVE

Article Title: Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing (RIPiT-Seq)

doi: 10.3791/59913

Figure Lengend Snippet: 7. Magnetic bead-antibody conjugation

Article Snippet: Add appropriate amount of antibody (exact amount of antibody to use for IP will need to be empirically determined for each antibody). table ft1 table-wrap mode="anchored" t5 Name of Material/ Equipment Company Catalog Number Comments/Description Anti-FLAG Affinity Gel Sigma A2220 ATP, [γ−32P]- 3000Ci/mmol 10mCi/ml EasyTide, 250μCi PerkinElmer BLU502A250UC BD Disposable Syringes with Luer-Lok™ Tips (200) Fisher 14–823–435 Betaine 5M Sigma B0300 biotin-dATP TriLink N-5002 biotin-dCTP Perkin Elmer NEL540001EA Branson Sonifier, Model SSE-1 Branson CircLigase I VWR 76081–606 DMEM, High Glucose ThermoFisher 11995–065 DNA load buffer NEB NEB Dynabeads Protein A LifeTech 10002D Flp-In-T-REx 293 Cell Line ThermoFisher {"type":"entrez-nucleotide","attrs":{"text":"R78007","term_id":"853117","term_text":"R78007"}} R78007 GeneRuler Low Range DNA Ladder ThermoScientific FERSM1203 Hygromycin B ThermoFisher 10687010 Mini-PROTEAN TBE Gel 10 well Bio-Rad 4565013 Mini-PROTEAN TBE-Urea Gel Bio-Rad 4566033 miRCAT-33 adapter 5′-TGGAATTCTCGGGTGCCAAGGddC-3′ Any this protocol is only compatible with the Illumina sequencing platform Mirus transIT-X2 transfection reagent Mirus MIR 6004 Mth RNA ligase NEB E2610S PE1.0 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3′ Any this protocol is only compatible with the Illumina sequencing platform PE2.0 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC*T-3′ Any this protocol is only compatible with the Illumina sequencing platform Phenol/Chloroform/Isoamyl Alcohol (25:24:1, pH 6.7, 100ml) Fisher BP1752I-100 Purple Gel Loading Dye (6x) NEB NEB #7025 Q5 DNA Polymerase NEB M0491S/L RNase I, E. coli, 1000 units Eppicenter N6901K SPIN-X column Corning CLS8160–24EA Streptavidin beads ThermoFisher 60210 Superscript III (SSIII) ThermoScientific 18080044 SybrGold ThermoFisher S11494 T4 Polynucleotide Kinase-2500U NEB M0201L T 4 RNL2 Tr.

Techniques: Sequencing, Transfection